EMBOSS: einverted


Program einverted

Function

Finds DNA inverted repeats

Description

This looks for inverted repeats (stem loops) in a nucleotide sequence.

It will find inverted repeats that include a proprtion of mismatches and gaps (bulges in the stem loop).

It works by finding alignments between the sequence and its reverse complement that exceed a threshold score. The score is calculated by summing the values of each match, the penalties of each mismatch and the large penalties of any gaps.

Secondary structures like inverted repeats in genomic sequences may be implicated in initiation of DNA replication.

Usage

Here is a sample session with einverted.

% einverted
Input sequence: embl:hsts1
Output file [hsts1.inv]: 
Gap penalty [12]: 
Minimum score threshold [50]: 
Match score [3]: 
Mismatch score [-4]: 

Command line arguments

   Mandatory qualifiers:
  [-sequence]          sequence   Sequence USA
  [-outfile]           outfile    Output file name
   -gap                integer    Gap penalty
   -threshold          integer    Minimum score threshold
   -match              integer    Match score
   -mismatch           integer    Mismatch score

   Optional qualifiers: (none)
   Advanced qualifiers: (none)

Mandatory qualifiers Allowed values Default
[-sequence]
(Parameter 1)
Sequence USA Readable sequence Required
[-outfile]
(Parameter 2)
Output file name Output file <sequence>.einverted
-gap Gap penalty Any integer value 12
-threshold Minimum score threshold Any integer value 50
-match Match score Any integer value 3
-mismatch Mismatch score Any integer value -4
Optional qualifiers Allowed values Default
(none)
Advanced qualifiers Allowed values Default
(none)

Input file format

The input for einverted is a nucleotide sequence

Output file format

Here is the output form the example run. The first two hits are removed to avoid the output lines being too wide.

......................

Score 80: 44/51 ( 86%) matches, 2 gaps
   12246 ctcctgcctcag-cctccaagtagctgggattaca-gcatgtgccaccatgcc 12296   
         |||||| ||||| | |||||   |||||||||||| ||||| |||||||| ||
   13938 gaggacagagtcagaaggtttcacgaccctaatgtccgtactcggtggtatgg 13886   

Score 99: 53/65 ( 81%) matches, 1 gaps
   13884 tgggtatggtggctcatgcctgtaatcccagcactttggaagactgagacaggagcaattgcttga 13949   
         ||||| |||||||   ||||||||||||||||    ||| || ||||| ||| || ||||||||||
   14692 acccacaccaccgtacacggacattagggtcgatggaccctccgactccgtcttc-ttaacgaact 14628   

Data files

Notes

References

Some references on inverted repeats:

  1. Pearson CE, Zorbas H, Price GB, Zannis-Hadjopoulos M Inverted repeats, stem-loops, and cruciforms: significance for initiation of DNA replication. J Cell Biochem 1996 Oct;63(1):1-22
  2. Waldman AS, Tran H, Goldsmith EC, Resnick MA. q Long inverted repeats are an at-risk motif for recombination in mammalian cells. Genetics. 1999 Dec;153(4):1873-83. PMID: 10581292; UI: 20050682
  3. Jacobsen SE Gene silencing: Maintaining methylation patterns. Curr Biol 1999 Aug 26;9(16):R617-9
  4. Lewis S, Akgun E, Jasin M. Palindromic DNA and genome stability. Further studies. Ann N Y Acad Sci. 1999 May 18;870:45-57. PMID: 10415472; UI: 99343961
  5. Dai X, Greizerstein MB, Nadas-Chinni K, Rothman-Denes LB Supercoil-induced extrusion of a regulatory DNA hairpin. Proc Natl Acad Sci U S A 1997 Mar 18;94(6):2174-9

Warnings

Diagnostic Error Messages

Exit status

Known bugs

See also

Program nameDescription
chaosCreate a chaos game representation plot for a sequence
cpgplotPlot CpG rich areas
cpgreportReports all CpG rich regions
diffseqFind differences (SNPs) between nearly identical sequences
dotmatcherDisplays a thresholded dotplot of two sequences
dotpathDisplays a non-overlapping wordmatch dotplot of two sequences
dottupDisplays a wordmatch dotplot of two sequences
equicktandemFinds tandem repeats
etandemLooks for tandem repeats in a nucleotide sequence
isochorePlots isochores in large DNA sequences
newcpgreportReport CpG rich areas
newcpgseekReports CpG rich regions
palindromeLooks for inverted repeats in a nucleotide sequence
polydotDisplays all-against-all dotplots of a set of sequences
redataSearch REBASE for enzyme name, references, suppliers etc
restrictFinds restriction enzyme cleavage sites
showseqDisplay a sequence with features, translation etc
silentSilent mutation RE scan
tfscanScans DNA sequences for transcription factors

Author(s)

This program was originally written by Richard Durbin and Jean Thierry-Mieg as part of the ACEDB genome database package.

This application was modified for inclusion in EMBOSS by Peter Rice (pmr@sanger.ac.uk) Informatics Division, The Sanger Centre, Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SA, UK.

History

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments