|
|
EMBOSS: einverted |
It will find inverted repeats that include a proprtion of mismatches and gaps (bulges in the stem loop).
It works by finding alignments between the sequence and its reverse complement that exceed a threshold score. The score is calculated by summing the values of each match, the penalties of each mismatch and the large penalties of any gaps.
Secondary structures like inverted repeats in genomic sequences may be implicated in initiation of DNA replication.
% einverted Input sequence: embl:hsts1 Output file [hsts1.inv]: Gap penalty [12]: Minimum score threshold [50]: Match score [3]: Mismatch score [-4]:
Mandatory qualifiers: [-sequence] sequence Sequence USA [-outfile] outfile Output file name -gap integer Gap penalty -threshold integer Minimum score threshold -match integer Match score -mismatch integer Mismatch score Optional qualifiers: (none) Advanced qualifiers: (none) |
| Mandatory qualifiers | Allowed values | Default | |
|---|---|---|---|
| [-sequence] (Parameter 1) |
Sequence USA | Readable sequence | Required |
| [-outfile] (Parameter 2) |
Output file name | Output file | <sequence>.einverted |
| -gap | Gap penalty | Any integer value | 12 |
| -threshold | Minimum score threshold | Any integer value | 50 |
| -match | Match score | Any integer value | 3 |
| -mismatch | Mismatch score | Any integer value | -4 |
| Optional qualifiers | Allowed values | Default | |
| (none) | |||
| Advanced qualifiers | Allowed values | Default | |
| (none) | |||
......................
Score 80: 44/51 ( 86%) matches, 2 gaps
12246 ctcctgcctcag-cctccaagtagctgggattaca-gcatgtgccaccatgcc 12296
|||||| ||||| | ||||| |||||||||||| ||||| |||||||| ||
13938 gaggacagagtcagaaggtttcacgaccctaatgtccgtactcggtggtatgg 13886
Score 99: 53/65 ( 81%) matches, 1 gaps
13884 tgggtatggtggctcatgcctgtaatcccagcactttggaagactgagacaggagcaattgcttga 13949
||||| ||||||| |||||||||||||||| ||| || ||||| ||| || ||||||||||
14692 acccacaccaccgtacacggacattagggtcgatggaccctccgactccgtcttc-ttaacgaact 14628
| Program name | Description |
|---|---|
| chaos | Create a chaos game representation plot for a sequence |
| cpgplot | Plot CpG rich areas |
| cpgreport | Reports all CpG rich regions |
| diffseq | Find differences (SNPs) between nearly identical sequences |
| dotmatcher | Displays a thresholded dotplot of two sequences |
| dotpath | Displays a non-overlapping wordmatch dotplot of two sequences |
| dottup | Displays a wordmatch dotplot of two sequences |
| equicktandem | Finds tandem repeats |
| etandem | Looks for tandem repeats in a nucleotide sequence |
| isochore | Plots isochores in large DNA sequences |
| newcpgreport | Report CpG rich areas |
| newcpgseek | Reports CpG rich regions |
| palindrome | Looks for inverted repeats in a nucleotide sequence |
| polydot | Displays all-against-all dotplots of a set of sequences |
| redata | Search REBASE for enzyme name, references, suppliers etc |
| restrict | Finds restriction enzyme cleavage sites |
| showseq | Display a sequence with features, translation etc |
| silent | Silent mutation RE scan |
| tfscan | Scans DNA sequences for transcription factors |
This application was modified for inclusion in EMBOSS by Peter Rice (pmr@sanger.ac.uk) Informatics Division, The Sanger Centre, Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SA, UK.