EMBOSS: tfscan


Program tfscan

Function

Scans DNA sequences for transcription factors

Description

Usage

Here is a sample session with tfscan.

% tfscan
Input sequence(s): embl:hsfos
Transcription Factor Class
         F : fungi
         I : insect
         P : plant
         V : vertebrate
         O : other
Select class [V]: v
Number of mismatches [0]: 
Output file [hsfos.tfscan]: 

Scanning HSFOS...


Command line arguments

   Mandatory qualifiers:
  [-sequence]          seqall     Sequence database USA
   -menu               list       Select class
   -mismatch           integer    Number of mismatches
  [-outfile]           outfile    Output file name

   Optional qualifiers: (none)
   Advanced qualifiers: (none)

Mandatory qualifiers Allowed values Default
[-sequence]
(Parameter 1)
Sequence database USA Readable sequence(s) Required
-menu Select class
F (fungi)
I (insect)
P (plant)
V (vertebrate)
O (other)
V
-mismatch Number of mismatches Integer 0 or more 0
[-outfile]
(Parameter 2)
Output file name Output file <sequence>.tfscan
Optional qualifiers Allowed values Default
(none)
Advanced qualifiers Allowed values Default
(none)

Input file format

Output file format

Here is part of the output from the example run. Some of the sites in TRANSFAC are extremely short.

TFSCAN of HSFOS from 1 to 6210

XENLA$VITB1_14       R04490   5200  5206  gcaaaca
XENLA$VITB1_14       R04490   4481  4487  gcaaaca

.................

HS$CFOS_19           R04047   412   438   caggatgtccatattaggacatctgcg
HS$CFOS_18           R04046   412   438   caggatgtccatattaggacatctgcg

.................

HS$CFOS_17           R03425   749   770   gagcaactgagaagccaagact

.................

HS$CFOS_16           R01889   420   429   ccatattagg

.................

HS$CFOS_15           R01640   412   419   caggatgt
MOUSE$CFOS_04        R00475   415   434   gatgtccatattaggacatc
MOUSE$CFOS_03        R00474   415   434   gatgtccatattaggacatc
MOUSE$CFOS_02        R00473   415   434   gatgtccatattaggacatc
MOUSE$CFOS_01        R00472   414   436   ggatgtccatattaggacatctg
HS$CFOS_14           R00471   669   676   gtgacgtt
HS$CFOS_13           R00470   649   656   gcgccacc
HS$CFOS_13           R00470   635   642   gcgccacc
HS$CFOS_12           R00469   1496  1502  tgcgtca
HS$CFOS_12           R00469   435   441   tgcgtca
HS$CFOS_11           R00468   1496  1502  tgcgtca
HS$CFOS_11           R00468   435   441   tgcgtca
HS$CFOS_10           R00467   415   434   gatgtccatattaggacatc
HS$CFOS_09           R00466   412   434   caggatgtccatattaggacatc
HS$CFOS_08           R00465   415   421   gatgtcc
HS$CFOS_07           R00464   415   434   gatgtccatattaggacatc
HS$CFOS_06           R00463   420   429   ccatattagg
HS$CFOS_05           R00462   415   434   gatgtccatattaggacatc
HS$CFOS_04           R00461   415   434   gatgtccatattaggacatc
HS$CFOS_03           R00460   401   440   ccccccttacacaggatgtccatattaggacatctgcg
tc
HS$CFOS_02           R00459   387   395   tcccgtcaa
HS$CFOS_01           R00458   383   397   cagttcccgtcaatc

Data files

Notes

References

Warnings

Diagnostic Error Messages

Exit status

Known bugs

See also

Program nameDescription
chaosCreate a chaos game representation plot for a sequence
cpgplotPlot CpG rich areas
cpgreportReports all CpG rich regions
diffseqFind differences (SNPs) between nearly identical sequences
dotmatcherDisplays a thresholded dotplot of two sequences
dotpathDisplays a non-overlapping wordmatch dotplot of two sequences
dottupDisplays a wordmatch dotplot of two sequences
dregregular expression search of a nucleotide sequence
einvertedFinds DNA inverted repeats
equicktandemFinds tandem repeats
etandemLooks for tandem repeats in a nucleotide sequence
fuzznucNucleic acid pattern search
fuzzproProtein pattern search
fuzztranProtein pattern search after translation
helixturnhelixReport nucleic acid binding motifs
isochorePlots isochores in large DNA sequences
newcpgreportReport CpG rich areas
newcpgseekReports CpG rich regions
palindromeLooks for inverted repeats in a nucleotide sequence
patmatdbSearch a protein sequence with a motif
patmatmotifsSearch a PROSITE motif database with a protein sequence
polydotDisplays all-against-all dotplots of a set of sequences
pregregular expression search of a protein sequence
printsextractExtract data from PRINTS
prosextractBuilds the PROSITE motif database for patmatmotifs to search
pscanScans proteins using PRINTS
redataSearch REBASE for enzyme name, references, suppliers etc
restrictFinds restriction enzyme cleavage sites
showseqDisplay a sequence with features, translation etc
silentSilent mutation RE scan
wobbleWobble base plot

Author(s)

This application was written by Alan Bleasby (ableasby@hgmp.mrc.ac.uk)

History

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments