|
|
EMBOSS: tfscan |
% tfscan
Input sequence(s): embl:hsfos
Transcription Factor Class
F : fungi
I : insect
P : plant
V : vertebrate
O : other
Select class [V]: v
Number of mismatches [0]:
Output file [hsfos.tfscan]:
Scanning HSFOS...
Mandatory qualifiers: [-sequence] seqall Sequence database USA -menu list Select class -mismatch integer Number of mismatches [-outfile] outfile Output file name Optional qualifiers: (none) Advanced qualifiers: (none) |
| Mandatory qualifiers | Allowed values | Default | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| [-sequence] (Parameter 1) |
Sequence database USA | Readable sequence(s) | Required | ||||||||||
| -menu | Select class |
|
V | ||||||||||
| -mismatch | Number of mismatches | Integer 0 or more | 0 | ||||||||||
| [-outfile] (Parameter 2) |
Output file name | Output file | <sequence>.tfscan | ||||||||||
| Optional qualifiers | Allowed values | Default | |||||||||||
| (none) | |||||||||||||
| Advanced qualifiers | Allowed values | Default | |||||||||||
| (none) | |||||||||||||
TFSCAN of HSFOS from 1 to 6210 XENLA$VITB1_14 R04490 5200 5206 gcaaaca XENLA$VITB1_14 R04490 4481 4487 gcaaaca ................. HS$CFOS_19 R04047 412 438 caggatgtccatattaggacatctgcg HS$CFOS_18 R04046 412 438 caggatgtccatattaggacatctgcg ................. HS$CFOS_17 R03425 749 770 gagcaactgagaagccaagact ................. HS$CFOS_16 R01889 420 429 ccatattagg ................. HS$CFOS_15 R01640 412 419 caggatgt MOUSE$CFOS_04 R00475 415 434 gatgtccatattaggacatc MOUSE$CFOS_03 R00474 415 434 gatgtccatattaggacatc MOUSE$CFOS_02 R00473 415 434 gatgtccatattaggacatc MOUSE$CFOS_01 R00472 414 436 ggatgtccatattaggacatctg HS$CFOS_14 R00471 669 676 gtgacgtt HS$CFOS_13 R00470 649 656 gcgccacc HS$CFOS_13 R00470 635 642 gcgccacc HS$CFOS_12 R00469 1496 1502 tgcgtca HS$CFOS_12 R00469 435 441 tgcgtca HS$CFOS_11 R00468 1496 1502 tgcgtca HS$CFOS_11 R00468 435 441 tgcgtca HS$CFOS_10 R00467 415 434 gatgtccatattaggacatc HS$CFOS_09 R00466 412 434 caggatgtccatattaggacatc HS$CFOS_08 R00465 415 421 gatgtcc HS$CFOS_07 R00464 415 434 gatgtccatattaggacatc HS$CFOS_06 R00463 420 429 ccatattagg HS$CFOS_05 R00462 415 434 gatgtccatattaggacatc HS$CFOS_04 R00461 415 434 gatgtccatattaggacatc HS$CFOS_03 R00460 401 440 ccccccttacacaggatgtccatattaggacatctgcg tc HS$CFOS_02 R00459 387 395 tcccgtcaa HS$CFOS_01 R00458 383 397 cagttcccgtcaatc
| Program name | Description |
|---|---|
| chaos | Create a chaos game representation plot for a sequence |
| cpgplot | Plot CpG rich areas |
| cpgreport | Reports all CpG rich regions |
| diffseq | Find differences (SNPs) between nearly identical sequences |
| dotmatcher | Displays a thresholded dotplot of two sequences |
| dotpath | Displays a non-overlapping wordmatch dotplot of two sequences |
| dottup | Displays a wordmatch dotplot of two sequences |
| dreg | regular expression search of a nucleotide sequence |
| einverted | Finds DNA inverted repeats |
| equicktandem | Finds tandem repeats |
| etandem | Looks for tandem repeats in a nucleotide sequence |
| fuzznuc | Nucleic acid pattern search |
| fuzzpro | Protein pattern search |
| fuzztran | Protein pattern search after translation |
| helixturnhelix | Report nucleic acid binding motifs |
| isochore | Plots isochores in large DNA sequences |
| newcpgreport | Report CpG rich areas |
| newcpgseek | Reports CpG rich regions |
| palindrome | Looks for inverted repeats in a nucleotide sequence |
| patmatdb | Search a protein sequence with a motif |
| patmatmotifs | Search a PROSITE motif database with a protein sequence |
| polydot | Displays all-against-all dotplots of a set of sequences |
| preg | regular expression search of a protein sequence |
| printsextract | Extract data from PRINTS |
| prosextract | Builds the PROSITE motif database for patmatmotifs to search |
| pscan | Scans proteins using PRINTS |
| redata | Search REBASE for enzyme name, references, suppliers etc |
| restrict | Finds restriction enzyme cleavage sites |
| showseq | Display a sequence with features, translation etc |
| silent | Silent mutation RE scan |
| wobble | Wobble base plot |